Page contents General information Genetically modified plant Genetic modification Experimental Release Environmental Impact and Risk Management Final report European Commission administrative Information Return to search

General information Notification Number B/IT/24/03 Member State to which the notification was sent Italy Date of acknowledgement from the Member State Competent Authority 18/06/2024 Title of the Project Open field trial with grapevine (Vitis vinifera L.) of the TEA/NGT-1 type, Chardonnay variety, deleted in the DMR6.1 gene for resistance to grapevine downy mildew. ACRONYM: VITEA.1 Proposed period of release: 31/07/2024 to 31/10/2028 Name of the Institute(s) or Company(ies) EdiVite, Sede Legale: Quartiere San Mauro 30, 35020 San Pietro Viminario (PD); Sede Operativa: Dipartimento di Biotecnologie, Università degli Studi di Verona, Strada Le Grazie 15; 37134 Verona (VR). ITALY
Is the same GMPt been notified elsewhere by the same notifier? No Has the same GMPt been notified elsewhere by the same notifier? No Genetically modified plant Complete name of the recipient or parental plant(s):

Common Name	Family Name	Genus	Species	Subspecies	Cultivar/breeding line
grapevine	vitaceae	vitis	vitis vinifera		Chardonnay clone 76

Description of the traits and characteristics which have been introduced or modified, including marker genes and previous modifications: The Chardonnay TEA/NGT-1 grapevine plant subject to this notification was obtained through a DNA-free genomic editing approach for the functional inactivation of the susceptibility gene to downy mildew, VviDMR6.1 (VIT_16s0098g00860; Vitvi16g01336). It contains a 49 bp deletion in allele 1 and a 1 bp deletion in allele 2 of the DMR6.1 gene. These modifications cause a frameshift in the RNA reading frame, resulting in the loss of function of the edited gene.This notification aims to evaluate the reduced susceptibility to Plasmopara viticola, the pathogen responsible for downy mildew, and to assess the possibility of reducing the use of phytosanitary products.No evident alteration in the morphology and development of the plant compared to control plants was observed in controlled environments such as phytotrons and greenhouses.Because of the genetic editing, the Chardonnay TEA/NGT-1 plant is expected to exhibit the following new traits:a) reduced susceptibility to grapevine downy mildew compared to control plants;b) potential reduced susceptibility to other diseases compared to control plants.The open field experimental trials will assess whether the agronomic and qualitative traits of the fruit differ from the control plants. Genetic modification Type of genetic modification: Deletion; In case of deletion of genetic material, give information on the function of the deleted sequences: Homozygous biallelic mutation in the grapevine DMR6.1 gene due to a DNA-free genome editing event (CRISPR/Cas9 system). The genetic variation introduced in the gene DMR6.1 consists of a deletion of n.49 bp (-TGTTATCCTCTGGATCAGTACACGCCTGAGTGGCCTTCCAATCCTCCTT) in the allele 1 of the second exon and a deletion of n. 1 bp (-T) in the allele 2 of the second exon of the gene.The genetic variation introduced in the gene DMR6.1 determines a frame shift in the coding sequence with the consequent production of a non-functional protein. The DMR6.1 gene is considered by many bibliographic sources to be an important susceptibility gene, i.e. one of those genes in plants that are exploited by pathogens to pave the way for infection and infect plants. The DMR6 gene family (acronym meaning Downy Mildew Resistant) was initially identified in the model plant species Arabidopsis thaliana in a population of mutants obtained following chemical mutagenesis. Mutants in some genes of the family showed reduced susceptibility to Hyaloperonospora parasitica, the oomycete that causes downy mildew in Arabidopsis, but also to Phytophthora capsici and the bacterium Pseudomonas syringae. The DMR6 gene encodes a 2-oxoglutarate (2OG)-Fe(II) oxygenase, whose function has recently been clarified; in particular DMR6 is involved in the catabolism of salicylic acid (SA), as the enzyme functions as SA-5-hydroxylase (S5H) and converts the active molecule of SA into the inactive form 2,5-DHBA (dihydrobenzenic acid). Since salicylic acid in plants is an important hormone that controls responses to pathogens, an enzyme that degrades salicylic acid has a negative regulatory function of immune defense in plants. Therefore, its inactivation can allow the plant to activate its defenses preventively and more intensely. Orthologous genes of DMR6 have also been identified in other species, in particular in tomato in which the targeted mutation of the Sldmr6-1 gene has effectively led to greater resistance to tomato downy mildew, but also to other fungal, oomycete and bacterial pathogens. In grapevine, targeted mutagenesis of the DMR6.1 and DMR6.2 genes in transgenic plants stably expressing the CRISPR/Cas9 molecular machinery has allowed us to demonstrate a reduced susceptibility to downy mildew agent also in this species, accompanied by higher levels of salicylic acid, as expected.  Brief description of the method used for the genetic modification: The Chardonay TEA/NGT-1 grapevine plant subject to this notification was obtained through a DNA-free genomic editing approach for the functional inactivation of the susceptibility gene to downy mildew, VviDMR6.1 (VIT_16s0098g00860; Vitvi16g01336). Protoplasts of Chardonnay grapevine were isolated from embryogenic calli and subsequently transfected via PEG with the CRISPR/Cas9 ribonucleoprotein complex, consisting of the Cas9 protein and a guide RNA specific to the target gene. The transfected protoplasts were subsequently cultured in the absence of selection markers. The regeneration of plants from a single cell occurred through the process of somatic embryogenesis. The determination of the editing at the target site of the VviDMR6.1 gene in the regenerated plants following the Cas9 protein's cut at the target site was verified by PCR analysis, amplifying the target region with specific primers and sequencing. If the recipient or parental plant is a forest tree species, describe ways and extent of dissemination and specific factors affecting dissemination: Not applicable Experimental Release Purpose of the release: The release of TEA/NGT-1 grapevine plants aims to verify in open field conditions the resistance to the pathogen Plasmopara viticola, the causal agent of downy mildew, and consequently to assess the possibility of reducing the use of phytosanitary products. The release of TEA/NGT-1 plants will be conducted in two different environments to evaluate the stability of the resistant phenotype, as well as the physiological and agronomic characteristics typical of the Chardonnay variety compared to the non-edited control.In controlled environment experiments, no substantial phenotypic variation was observed regarding the persistence or invasiveness of the Chardonnay TEA/NGT-1 compared to control plants. Geographical location of the site: Two different sites were identified within the Veneto Region in order to evaluate the stability of the resistant phenotype together with the physiological, agronomical and oenological characteristics of the Chardonnay variety. Site N1: 45°30'56.9"N 10°54'33.1''E. It is located at the experimental/educational field of BIOTECH-UNIVR based at Villa Ottolini Lebrecht, San Floriano, a hamlet of San Pietro in Cariano, Verona. Site N2: 45°14'38.8''N 11°.49'41.7''E. It is located at the agricultural company VITITALY SOCIETA' AGRICOLA S.S., in Via Roma 34/A, 35020, San Pietro Viminario, Padova. Size of the site (m2): The experimental field at site N1 is 250 mq, while the size of the experimental field at site N2 is 500 mq. Relevant data regarding previous releases carried out with the same GM-plant, if any, specifically related to the potential environmental and human health impacts from the release: N/A Environmental Impact and Risk Management Summary of the potential environmental impact from the release of the GMPts: Grapevines, including Chardonnay TEA/NGT-1 plants, have very specific cultivation requirements that make them unsuitable for surviving outside an agricultural context. The mechanism of resistance to downy mildew is based on the inactivation of a susceptibility gene (DMR6.1) that prevents the pathogen from infecting grapevine plants. The transfer of the mutation introduced through editing in the DMR6.1 edited line to other conventional grapevine plants can only occur through crossbreeding, which is a very remote possibility in nature, and the design of experimental fields aims to prevent such transfer. In any case, it is reiterated that cultivated grapevines are propagated by grafting cuttings and not through seeds; therefore, the plant population established in the VITEA.1 project is strictly limited in number and cannot increase spontaneously.The Chardonnay TEA/NGT-1 plants involved in this experimental request do not contain any new inserts, transgenes, or antibiotic resistance genes, so any spontaneous horizontal gene transfer phenomena in nature are not influenced by the Chardonnay TEA/NGT-1 plants in question. The target organism of the modification introduced by editing is Plasmopara viticola, the agent of grapevine downy mildew. No negative environmental effects are foreseen due to the activation of resistance mechanisms.Potential non-target organisms affected by genetic modification could be microorganisms that live in close relationship with the plant and within it, such as mycorrhizae or endophytes, which may find it harder to colonize due to increased resistance to microbial infections. Any changes to endophytic populations, which sometimes play a positive role in plant health, will be evaluated during experimental trials. It is expected that the resistance mediated by DMR6.1 might also be effective against other harmful organisms not directly related to Plasmopara viticola, thus potentially reducing the environmental impact of pesticides compared to wild-type plants, to be assessed in field trials.No negative changes in agricultural practices are foreseeable due to the use of Chardonnay TEA/NGT-1 plants in this notification. Agricultural practice changes will primarily involve a reduction in anti-downy mildew treatments or potentially fungicide treatments if the plants exhibit broader resistance. Furthermore, the proposed experiment has no effects on biogeochemical cycles different from those of normal grapevine cultivation in open fields. Finally, no negative effects are foreseeable on human and animal health due to the experimentation of the plants in question. On the contrary, a positive effect can be hypothesized due to the reduced use of herbicides during the experiment. Brief description of any measures taken for the management of risks: Vitis vinifera is a self-pollinating and cleistogamous plant, so the possibility of pollen from an edited plant fertilizing non-edited plants is very low, almost negligible. The species in question is propagated exclusively vegetatively, and seeds are not used to spread the species. Additionally, the Chardonnay variety flowers early, further reducing this risk.The land used for the experimental trial at both sites is enclosed with a metal fence and accessible only to personnel from EdiVite S.r.l. and UNIVR, always under the supervision of the Scientific Director. Visual inspections will be conducted bi-weekly, and the sites will be monitored via video surveillance to prevent intrusions, with rodent traps to reduce the entry of other organisms. The areas will be kept weed-free through harrowing and herbicides. These measures ensure rigorous monitoring and environmental safety during the experiment.The grape clusters will be harvested manually and safely transported for analysis, while unused seeds will be devitalized. After each pruning, the residues will be shredded and buried, and agricultural tools will be cleaned after each use. The plants will not receive fungicide treatments until the fruit set phase to evaluate disease resistance. At the end of the season, fungicide treatments will be performed to maintain plant vitality. Fertilizers and a drip irrigation system will be used to prevent runoff. The experiment will last at least four years, with the collection and analysis of ripe clusters and the disposal of residues as special waste. At the end, the plants will be uprooted, and plant residues buried, with a six-month monitoring period to eliminate any seedlings.The plants will be evaluated weekly for downy mildew infections, comparing the data with control plants. In case of emergencies, the plants will be treated with herbicides, uprooted, and incinerated, and any issues will be reported to the relevant ministries. In case of natural disasters, the destruction of the plants will be implemented. Summary of foreseen field trial studies focused to gain new data on environmental and human health impact from the release: Not applicable Final report - European Commission administrative Information Consent given by the Member State Competent Authority: Not known